bms1l

Ensembl ID:
ENSDARG00000054154
ZFIN ID:
ZDB-GENE-060720-2
Description:
ribosome biogenesis protein BMS1 homolog [Source:RefSeq peptide;Acc:NP_001104620]
Human Orthologues:
AC126335.2, AC126603.2, AC142384.1, AL512662.1, AL589182.2, BMS1
Human Descriptions:
BMS1 homolog, ribosome assembly protein (yeast) [Source:HGNC Symbol;Acc:23505]
Putative BMS1-like protein ENSP00000383048 [Source:UniProtKB/Swiss-Prot;Acc:A8MXU9]
Putative BMS1-like protein ENSP00000383088 [Source:UniProtKB/Swiss-Prot;Acc:A8MV67]
Putative BMS1-like protein [Source:UniProtKB/Swiss-Prot;Acc:Q6IPT3]
Mouse Orthologue:
Bms1
Mouse Description:
BMS1 homolog, ribosome assembly protein (yeast) Gene [Source:MGI Symbol;Acc:MGI:2446132]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa27975 Nonsense Mutation detected in F1 DNA During 2017
sa9116 Essential Splice Site Mutation detected in F1 DNA During 2017
sa35313 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa27975
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053761 Nonsense 62 1221 3 23
ENSDART00000102261 Nonsense 59 453 3 11
ENSDART00000126367 Nonsense 59 515 3 12
ENSDART00000130032 Nonsense 62 1221 2 22
ENSDART00000130172 Nonsense 62 549 3 10
Genomic Location (Zv9):
Chromosome 12 (position 30789252)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 29126189
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAATGATTTTTCATTCATTTTAATGGCTCTTAATGTTGTTTTGTAGGGCA[C/T]AGGATATTAAAACAAAGAAACATCACATTCCCCTTGTTGACCGGACGCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9116
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053761 Essential Splice Site 213 1221 5 23
ENSDART00000102261 Essential Splice Site 210 453 5 11
ENSDART00000126367 Essential Splice Site 210 515 5 12
ENSDART00000130032 Essential Splice Site 213 1221 4 22
ENSDART00000130172 Essential Splice Site 213 549 5 10
Genomic Location (Zv9):
Chromosome 12 (position 30792332)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 29129269
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAAACAAAGAAACGCCTYAAAGACCGGTTCTGGACTGAAGTTTTCCAGG[T/C]ACGTCAGAGACCMTTTWTTTAACAGACTTATCWTTGAAGAGAACTGTATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35313
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053761 Nonsense 1169 1221 23 23
ENSDART00000102261   None 453 None 11
ENSDART00000126367   None 515 None 12
ENSDART00000130032 Nonsense 1169 1221 22 22
ENSDART00000130172   None 549 None 10
Genomic Location (Zv9):
Chromosome 12 (position 30817554)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 29154491
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGCTCTGACCACAGTCTACTCATACAAGACTAAGAAGGCGATTGCAGAA[C/T]AACGCACCAAACACAAAGAATTCCTGAAGCAGAAAGAGAAACAGGAAGCG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link