cx23

Ensembl ID:
ENSDARG00000054150
ZFIN ID:
ZDB-GENE-050320-121
Description:
connexin 23 [Source:RefSeq peptide;Acc:NP_001013564]
Mouse Orthologue:
Gje1
Mouse Description:
gap junction protein, epsilon 1 Gene [Source:MGI Symbol;Acc:MGI:1923993]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23771 Essential Splice Site Mutation detected in F1 DNA During 2014
sa18264 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23771
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076293 Essential Splice Site 13 207 1 3
ENSDART00000140450 None None 141 None 3
Genomic Location:
Chromosome 20 (position 37319785)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAGCCAAATTATGTCATTAAATTACATCAAAAACTTTTATGAAGGATGC[G/A]TAAGTATGCAGTTGACCTTATCTGTATTCAGTAGATGCATCATGTCTGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18264
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076293 Nonsense 131 207 3 3
ENSDART00000140450 Nonsense 128 141 3 3
Genomic Location:
Chromosome 20 (position 37321689)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTACATCATCTCWGTCCTGTTAAGAATAATTCTAGAAGTCTTAGCSTTTT[G/A]GCTACAGAGCCACCTTTTTGGTTTCCTGGTTGATCCTATTTTCATGTGCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ugwdqwv3