gpr126

Ensembl ID:
ENSDARG00000054137
ZFIN ID:
ZDB-GENE-041014-357
Description:
G-protein coupled receptor 126 [Source:UniProtKB/Swiss-Prot;Acc:C6KFA3]
Human Orthologue:
GPR126
Human Description:
G protein-coupled receptor 126 [Source:HGNC Symbol;Acc:13841]
Mouse Orthologue:
Gpr126
Mouse Description:
G protein-coupled receptor 126 Gene [Source:MGI Symbol;Acc:MGI:1916151]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa25142 Splice Site, Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa25142
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076275 Splice Site, Nonsense 1169 1227 20 20
ENSDART00000125854   None 1185 None 24
ENSDART00000128321 Splice Site None 1275 31 31
ENSDART00000145927 Splice Site, Nonsense 1170 1228 19 19

The following transcripts of ENSDARG00000054137 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 37493798)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 37566311
KASP Assay ID:
554-7569.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATGTATCATATTTAGTCCCTCACTCAAGCATTGTGACATATTTGCAGGT[A/T]AAAGTTCCTCCAATCAGAGCAGTCCCAAATGCAGCCCTTCTGACGGAGAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link