Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
htr1bd
- Ensembl ID:
- ENSDARG00000054124
- ZFIN ID:
- ZDB-GENE-090409-3
- Description:
- 5-hydroxytryptamine (serotonin) receptor 1bd [Source:RefSeq peptide;Acc:NP_001139158]
- Human Orthologue:
- HTR1D
- Human Description:
- 5-hydroxytryptamine (serotonin) receptor 1D [Source:HGNC Symbol;Acc:5289]
- Mouse Orthologue:
- Htr1d
- Mouse Description:
- 5-hydroxytryptamine (serotonin) receptor 1D Gene [Source:MGI Symbol;Acc:MGI:96276]
Alleles
There is 1 allele of this gene:
| Allele name | Consequence | Status | Availability Estimate |
|---|---|---|---|
| sa25042 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa25042
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000042501 | Nonsense | 153 | 386 | 1 | 1 |
- Genomic Location (Zv9):
- Chromosome 17 (position 28227198)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 17 28151125 GRCz11 17 28168088 - KASP Assay ID:
- 554-7369.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CACGGACGCCTTGGAGTACTCGAAACGGAGAACCATGCGGCGAGCAGCGT[T/A]GATGATTGTCATAGTATGGGTGATCTCCGTCTCTATCTCTTTACCTCCTC
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Height: Hundreds of variants clustered in genomic loci and biological pathways affect human height. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:
