rbm41

Ensembl ID:
ENSDARG00000054096
ZFIN ID:
ZDB-GENE-041114-107
Description:
RNA-binding protein 41 [Source:RefSeq peptide;Acc:NP_001007406]
Human Orthologue:
RBM41
Human Description:
RNA binding motif protein 41 [Source:HGNC Symbol;Acc:25617]
Mouse Orthologue:
Rbm41
Mouse Description:
RNA binding motif protein 41 Gene [Source:MGI Symbol;Acc:MGI:2444923]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa29645 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa29645
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076238 Nonsense 323 439 5 7
Genomic Location (Zv9):
Chromosome 21 (position 36983521)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 37972559
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGAGATCAAGAGCAATCGAGAGACAGAAGAGGCCATAAGGAACATTCCT[C/T]GATTTAAGAACTACCAGAGGGGAAAACCATCCAAAGTAAGTGCAGATGAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link