LOC559281

Ensembl ID:
ENSDARG00000054087
Human Orthologue:
IRS1
Human Description:
insulin receptor substrate 1 [Source:HGNC Symbol;Acc:6125]
Mouse Orthologue:
Irs1
Mouse Description:
insulin receptor substrate 1 Gene [Source:MGI Symbol;Acc:MGI:99454]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35963 Nonsense Mutation detected in F1 DNA During 2016
sa42600 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa35963
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076229 Nonsense 167 1099 1 2
Genomic Location (Zv9):
Chromosome 15 (position 35196809)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 36071000
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAACCAAAGGGTCTGGGTCACACAAAGAACTTGATTGGAGTTTACAGAT[T/G]ATGCCTCACCAATAAGACTATCAGCTTTGTGAAACTGAATTCGGATGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42600
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076229 Nonsense 708 1099 1 2
Genomic Location (Zv9):
Chromosome 15 (position 35195187)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 36069378
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCCCCGCTCATTCAAACATGCTAACAGGAAGCAGGATCAGAGCCCGCTT[C/T]GAGTGTCACTGGGCTCGAGTCGATTAGCATACGCTGACTCCTCTTCATCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link