LOC559281

Ensembl ID:
ENSDARG00000054087
Human Orthologue:
IRS1
Human Description:
insulin receptor substrate 1 [Source:HGNC Symbol;Acc:6125]
Mouse Orthologue:
Irs1
Mouse Description:
insulin receptor substrate 1 Gene [Source:MGI Symbol;Acc:MGI:99454]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35963 Nonsense Mutation detected in F1 DNA During 2016
sa28509 Nonsense Mutation detected in F1 DNA Unknown
sa4621 Nonsense Mutation detected in F1 DNA During 2016
sa42600 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa35963
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076229 Nonsense 167 1099 1 2
Genomic Location:
Chromosome 15 (position 35196809)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAACCAAAGGGTCTGGGTCACACAAAGAACTTGATTGGAGTTTACAGAT[T/G]ATGCCTCACCAATAAGACTATCAGCTTTGTGAAACTGAATTCGGATGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28509
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Unknown
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076229 Nonsense 521 1099 1 2
Genomic Location:
Chromosome 15 (position 35195748)
KASP Assay ID:
2260-8837.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGCCTGCTGCATCTTTAGAGGAATACACTGTGATGATGCCTACATACCCA[C/T]GAAGCCGCTCTGCATCATCGTCATCATCAACATATAGGCACTCATTCATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4621
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076229 Nonsense 629 1099 1 2
Genomic Location:
Chromosome 15 (position 35195422)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGAWGATGTCACCAAGTGGCAGCTGCTCTCCAGATGGCACAACAAACTA[T/A]GGCAAGATCTGGACGAATGGCATCAACCCTAAGCTCTCCGTAGAGAGTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42600
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076229 Nonsense 708 1099 1 2
Genomic Location:
Chromosome 15 (position 35195187)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCCCCGCTCATTCAAACATGCTAACAGGAAGCAGGATCAGAGCCCGCTT[C/T]GAGTGTCACTGGGCTCGAGTCGATTAGCATACGCTGACTCCTCTTCATCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link