im:7142760

Ensembl ID:
ENSDARG00000054032
ZFIN IDs:
ZDB-GENE-041111-166, ZDB-GENE-050706-110
Description:
ras-related protein Rab-24 [Source:RefSeq peptide;Acc:NP_001025141]
Human Orthologue:
RAB24
Human Description:
RAB24, member RAS oncogene family [Source:HGNC Symbol;Acc:9765]
Mouse Orthologue:
Rab24
Mouse Description:
RAB24, member RAS oncogene family Gene [Source:MGI Symbol;Acc:MGI:105065]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11953 Nonsense Available for shipment Available now
sa19269 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa11953
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076157 Nonsense 70 202 4 9
ENSDART00000076157 Nonsense 70 202 4 9
Genomic Location:
Chromosome 21 (position 37694906)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATGTCATGCATTTTCTTTCAATACAGGACACCGCTGGGTCTGAACGTTA[T/G]GAAGCAATGAGCAGAATTTACTACAGAGGAGCTCGTGCTGCCATTGTCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19269
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076157 Nonsense 70 202 4 9
ENSDART00000076157 Nonsense 70 202 4 9
Genomic Location:
Chromosome 21 (position 37694906)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATGTCATGCATTTTCTTTCAATACAGGACACCGCTGGGTCTGAACGTTA[T/G]GAAGCAATGAGCAGAATTTACTACAGAGGAGCTCGTGCTGCCATTGTCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/9evnnsfn