hoxb5b

Ensembl ID:
ENSDARG00000054030
ZFIN ID:
ZDB-GENE-000823-6
Description:
Homeobox protein Hox-B5b [Source:UniProtKB/Swiss-Prot;Acc:P09013]
Human Orthologue:
HOXB5
Human Description:
homeobox B5 [Source:HGNC Symbol;Acc:5116]
Mouse Orthologue:
Hoxb5
Mouse Description:
homeobox B5 Gene [Source:MGI Symbol;Acc:MGI:96186]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa42041 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa42041
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076161 Nonsense 246 276 2 2
Genomic Location (Zv9):
Chromosome 12 (position 28701973)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 27039582
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAGGAGAATAGAGATAGCTCACGCTCTCTGCCTCTCAGAGAGGCAAATC[A/T]AAATCTGGTTCCAAAATCGCAGGATGAAATGGAAGAAGGACAATAAACTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Obesity: A genome-wide association meta-analysis identifies new childhood obesity loci. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link