cu137686.1

Ensembl ID:
ENSDARG00000054028
ZFIN IDs:
ZDB-GENE-030131-7027, ZDB-GENE-081031-13, ZDB-GENE-081031-14
Description:
Wu:fk66a11 protein [Source:UniProtKB/TrEMBL;Acc:Q6AZB4]
Human Orthologue:
ATP11B
Human Description:
ATPase, class VI, type 11B [Source:HGNC Symbol;Acc:13553]
Mouse Orthologue:
Atp11b
Mouse Description:
ATPase, class VI, type 11B Gene [Source:MGI Symbol;Acc:MGI:1923545]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16252 Essential Splice Site Available for shipment Available now
sa11368 Nonsense Available for shipment Available now
sa9669 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa16252
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076151 Essential Splice Site 235 1149 8 30
ENSDART00000134544 Essential Splice Site 157 1000 5 25
Genomic Location:
Chromosome 22 (position 39988048)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTTTRTCGGGAGAATAACAGTAACCCAGCATGGAGAGGAGATMGTCAGG[T/C]AAGGCTTYAGTTYACTCGATYAGAGGAAWTAAAATCATTTGTAGATGTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11368
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076151 Nonsense 300 1149 11 30
ENSDART00000134544 Nonsense 222 1000 8 25
Genomic Location:
Chromosome 22 (position 39986257)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAGATCAATGAATAYATTTCTCATCATCTACTTGGGCATCCTGCWGTTT[G/T]AAGCCATCCTCAGCACCAYTTTAAAGTACGCCTGGCAGGCGGAGGACAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9669
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076151 Essential Splice Site 723 1149 19 30
ENSDART00000134544 Essential Splice Site 645 1000 16 25
Genomic Location:
Chromosome 22 (position 39969077)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGAAATCAGACAACGAGTGCGCAGAGCAGCTCCGCAGGCTGGCCCGGAG[G/A]TACACAGATTCACACASCATTCAAGTGTATTTWTTTYACTCAGCAGTGGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/q6lyxwxy