hoxb8b

Ensembl ID:
ENSDARG00000054025
ZFIN ID:
ZDB-GENE-980526-291
Description:
Homeobox protein Hox-B8b [Source:UniProtKB/Swiss-Prot;Acc:Q8JH55]
Human Orthologue:
HOXB8
Human Description:
homeobox B8 [Source:HGNC Symbol;Acc:5119]
Mouse Orthologue:
Hoxb8
Mouse Description:
homeobox B8 Gene [Source:MGI Symbol;Acc:MGI:96189]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa42040 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa42040
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076154 Nonsense 34 247 1 2
Genomic Location (Zv9):
Chromosome 12 (position 28688946)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 27026555
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTCTCTGCGCTCCAACTACTATGACTGCCCAAGCTACACGCCGGATCTT[G/T]GAGGCAGACCATCTGTGCTGTACGGTCACAACACAGGATCTGCGTTTCAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link