A8KC35_DANRE

Ensembl ID:
ENSDARG00000054010
Description:
LOC553490 protein [Source:UniProtKB/TrEMBL;Acc:A8KC35]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa10256 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10256
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103246 Nonsense 281 571 6 6
ENSDART00000121445 Nonsense 281 563 6 7
ENSDART00000123672 Nonsense 281 433 6 7
Genomic Location:
Chromosome 3 (position 32619368)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCATCATCATCATTTACACATCCATGCAATGATGGACAGAGCGAGAGTT[T/A]AGAAAATGATATATACGACCCCTTTCACCCAACTGAGGGTGAGGGGGAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/znt66elb