A8WGL8_DANRE

Ensembl ID:
ENSDARG00000053992
Description:
Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:A8WGL8]
Human Orthologue:
SFI1
Human Description:
Sfi1 homolog, spindle assembly associated (yeast) [Source:HGNC Symbol;Acc:29064]
Mouse Orthologue:
Sfi1
Mouse Description:
Sfi1 homolog, spindle assembly associated (yeast) Gene [Source:MGI Symbol;Acc:MGI:1926137]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20783 Essential Splice Site Mutation detected in F1 DNA During 2014
sa20782 Nonsense Mutation detected in F1 DNA During 2014
sa5754 Nonsense F2 line generated During 2014
sa2293 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20783
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076097 Essential Splice Site 254 921 7 25
Genomic Location:
Chromosome 6 (position 40844730)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAACGCACAGAGAAACGAGAGCAGAAAGAGCGAGCTGAACAGCAGTATAG[G/A]TCAGTTTCAGTGATTGCATGCTATGTGCAGGTAGATGATCATGTGTGATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20782
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076097 Nonsense 562 921 18 25
Genomic Location:
Chromosome 6 (position 40838805)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAAGCGTTTGACTGAGGCAGCTCAGTTTTATAGAGATGAACTGTTGCGA[G/T]AGGGCGTCACACACATCCTTACACACACGGCACATATGAATGCTTTCTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5754
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076097 Nonsense 599 921 19 25
ENSDART00000076097 Nonsense 599 921 19 25
Genomic Location:
Chromosome 6 (position 40838586)
KASP Assay ID:
554-2613.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAATCTGCATACTGTWCAGAGCTGTYGTCAGCTTCAGGAGGTGGTGAGG[C/T]GATGCGCTCTTCGATGGAAGCAGCGTGCGCTATGCAAACCTGTCAAGGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2293
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076097 Nonsense 599 921 19 25
ENSDART00000076097 Nonsense 599 921 19 25
Genomic Location:
Chromosome 6 (position 40838586)
KASP Assay ID:
554-2613.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAATCTGCATACTGTWCAGAGCTGTYGTCAGCTTCAGGAGGTGGTGAGG[C/T]GATGCGCTCTTCGATGGAAGCAGCGTGCGCTATGCAAACCTGTCAAGGAT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/3mn86ta4