NP_001122181.1

Ensembl ID:
ENSDARG00000053987
Description:
5-hydroxytryptamine receptor 1B [Source:RefSeq peptide;Acc:NP_001122181]
Human Orthologue:
HTR1B
Human Description:
5-hydroxytryptamine (serotonin) receptor 1B [Source:HGNC Symbol;Acc:5287]
Mouse Orthologue:
Htr1b
Mouse Description:
5-hydroxytryptamine (serotonin) receptor 1B Gene [Source:MGI Symbol;Acc:MGI:96274]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa15563 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15563
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076115 Nonsense 166 380 1 1
Genomic Location (Zv9):
Chromosome 17 (position 36756392)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 36641289
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCAAGAAACGCACCCAGGCGCGCGCCGCGGGGATGGTGGCGACCGCCTG[G/A]ATCATCGCCATCTCCATCTCCCTGCCRCCTTTCTTYTGGCGACAGGTRAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link