bc2

Ensembl ID:
ENSDARG00000053979
ZFIN ID:
ZDB-GENE-040426-2922
Description:
Charged multivesicular body protein 2a [Source:UniProtKB/Swiss-Prot;Acc:Q7ZW25]
Human Orthologue:
CHMP2A
Human Description:
chromatin modifying protein 2A [Source:HGNC Symbol;Acc:30216]
Mouse Orthologue:
Chmp2a
Mouse Description:
chromatin modifying protein 2A Gene [Source:MGI Symbol;Acc:MGI:1916203]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22108 Nonsense Available for shipment Available now
sa8643 Nonsense Mutation detected in F1 DNA During 2017
sa4469 Essential Splice Site F2 line generated During 2017

Mutation Details

Allele Name:
sa22108
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076103 Nonsense 38 220 2 6

The following transcripts of ENSDARG00000053979 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 12 (position 28600864)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 26938473
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATTAAATAGAGCCATGCGGGATCTAGACAGAGAACGGCAGAGACTGGAG[C/T]AGCAGGAAAAGAAAATAATCGCAGACATAAAAAAAATGGCCAAACAAGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8643
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076103 Nonsense 105 220 3 6

The following transcripts of ENSDARG00000053979 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 12 (position 28600591)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 26938200
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTAAAATTCAAACCCTCAAATCAAACAACAGCATGGCGCAGGCCATGAAA[G/T]GAGTCACCAAAGCTATGGCCACCATGAACAGACAGGYACTGTACAKCCGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4469
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076103 Essential Splice Site 116 220 None 6

The following transcripts of ENSDARG00000053979 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 12 (position 28600554)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 26938163
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAGGCCATGAAAGGAGTCACCAAAGCTATGGCCACCATGAACAGACAGG[T/C]ACTGTACAKCCGCTAAAAAGTCCTGCCAACAGAKAGTTTGTTCTTACGCN
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link