NP_001093459.1

Ensembl ID:
ENSDARG00000053956
Description:
spectrin beta chain, brain 1 [Source:RefSeq peptide;Acc:NP_001093459]
Human Orthologue:
SPTBN2
Human Description:
spectrin, beta, non-erythrocytic 2 [Source:HGNC Symbol;Acc:11276]
Mouse Orthologue:
Spnb3
Mouse Description:
spectrin beta 3 Gene [Source:MGI Symbol;Acc:MGI:1313261]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12446 Nonsense Available for shipment Available now
sa40508 Nonsense Mutation detected in F1 DNA During 2017
sa40509 Essential Splice Site Mutation detected in F1 DNA During 2017
sa40510 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa12446
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097723 Nonsense 129 2393 3 42
Genomic Location (Zv9):
Chromosome 5 (position 39277426)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 37077110
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAGGATCGGTGACCTYTACACTGAYCTCCGCGATGGACGCATGCTYATT[C/T]GACTGCTGGAGGTTCTCTCCGGGGAACAACTGGTCAGTATACCTTCAGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40508
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097723 Nonsense 695 2393 14 42
Genomic Location (Zv9):
Chromosome 5 (position 39288391)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 37088075
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACTCTGGCAGTTCCTGTGGGAGCTGGGAGAAGAGGCCGCCTGGATCCGA[G/T]AGCAGGAGCAGATCATCTCTGGAGGAGACTACGGTAAAGATCTGAGCTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40509
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097723 Essential Splice Site 975 2393 18 42
Genomic Location (Zv9):
Chromosome 5 (position 39291056)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 37090740
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCGCAACAAAGACCAGATTGACCAGACACAAAACCAACTCAATAACAGG[T/C]ACCGTCACCAACACAGAGAGCAGAGCCTCTAAAAACAAACATGTGTACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40510
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097723 Essential Splice Site 1048 2393 19 42
Genomic Location (Zv9):
Chromosome 5 (position 39291396)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 37091080
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCTACAGCGCAAGCTCACTGGAATGGAGAGAGACCTGGAAGCCATACAG[G/T]TACAAAAATGTGCATCAGGTCAAATGCAATCATGAAGAGACCCAATCATG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Bipolar disorder: Large-scale genome-wide association analysis of bipolar disorder identifies a new susceptibility locus near ODZ4. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link