lin37

Ensembl ID:
ENSDARG00000053950
ZFIN ID:
ZDB-GENE-050417-446
Description:
lin-37 homolog [Source:RefSeq peptide;Acc:NP_001017888]
Human Orthologue:
LIN37
Human Description:
lin-37 homolog (C. elegans) [Source:HGNC Symbol;Acc:33234]
Mouse Orthologue:
Lin37
Mouse Description:
lin-37 homolog (C. elegans) Gene [Source:MGI Symbol;Acc:MGI:1922910]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa15092 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa15092
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076066 Essential Splice Site 211 236 9 10
Genomic Location:
Chromosome 15 (position 36297708)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CRACACTAATGTTCAATCATATCAAACGCTGGAAGAAAATYAGACAGAAG[T/A]ATGCTTTTACTTTATCATTCTTTCATTACTCTTAAAATTATGGGGGTTTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/wqq0ctm5