dhx38

Ensembl ID:
ENSDARG00000053946
ZFIN IDs:
ZDB-GENE-040426-1144, ZDB-GENE-040426-1144
Description:
pre-mRNA-splicing factor ATP-dependent RNA helicase PRP16 [Source:RefSeq peptide;Acc:NP_957170]
Human Orthologue:
DHX38
Human Description:
DEAH (Asp-Glu-Ala-His) box polypeptide 38 [Source:HGNC Symbol;Acc:17211]
Mouse Orthologue:
Dhx38
Mouse Description:
DEAH (Asp-Glu-Ala-His) box polypeptide 38 Gene [Source:MGI Symbol;Acc:MGI:1927617]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa30637 Nonsense Mutation detected in F1 DNA During 2018
sa45302 Nonsense Mutation detected in F1 DNA During 2018
sa27096 Splice Site, Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa30637
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076056 Nonsense 355 1258 8 27
ENSDART00000128289 Nonsense 355 1258 7 28
Genomic Location (Zv9):
Chromosome 7 (position 69813694)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 67536363
GRCz11 7 67759715
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACGTACTAACTAGTAGTTTCATGTCCAAACAGCAAGCGGATCGAGACTG[G/A]TACATGATGGATGAAGGTTATGACGAGTTTCACAACCCACTGACATCCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45302
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076056 Nonsense 1152 1258 24 27
ENSDART00000128289 Nonsense 1152 1258 23 28
Genomic Location (Zv9):
Chromosome 7 (position 69838524)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 67561193
GRCz11 7 67784545
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAGCGCTTTGTTCGGGATGGGCTACACCCCTGACTACATCATCTACCAT[G/T]AACTGGTCATGACCACAAAGGTACTACTTCCTCCTCAGTCCGTTAATGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27096
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076056 Splice Site, Nonsense 1190 1258 25 27
ENSDART00000128289 Splice Site, Nonsense 1190 1258 24 28
Genomic Location (Zv9):
Chromosome 7 (position 69840728)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 67563397
GRCz11 7 67786749
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGAGCTGGGACCAATGTTCTACAGCATCAAACACGCAGGGAAGAGCAGA[C/T]AGGTGCGCAAATTCAAATCACACCCAACACTTAATAAGAGTGTGCAGTAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link