si:ch211-10e8.6

Ensembl ID:
ENSDARG00000053934
ZFIN ID:
ZDB-GENE-040724-118
Description:
Haloacid dehalogenase-like hydrolase domain-containing protein 3 [Source:UniProtKB/Swiss-Prot;Acc:Q7
Human Orthologue:
HDHD3
Human Description:
haloacid dehalogenase-like hydrolase domain containing 3 [Source:HGNC Symbol;Acc:28171]
Mouse Orthologue:
Hdhd3
Mouse Description:
haloacid dehalogenase-like hydrolase domain containing 3 Gene [Source:MGI Symbol;Acc:MGI:1919998]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa9862 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa9862
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103773 Essential Splice Site 130 213 None 4
ENSDART00000103776   130 242 2 2
Genomic Location (Zv9):
Chromosome 6 (position 40950182)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 41021782
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATTCTAACAGCACCCTGAAGTCCTGCACCGCTTTGGGACTCAAGCAAGG[T/A]GTTGTTTCCAACTTCGACAGGCGTTTGGAAGGGATCCTGAGRRGATGCGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link