ENSDARG00000053931

Ensembl ID:
ENSDARG00000053931
Human Orthologues:
C3AR1, C5AR1
Human Descriptions:
complement component 3a receptor 1 [Source:HGNC Symbol;Acc:1319]
complement component 5a receptor 1 [Source:HGNC Symbol;Acc:1338]
Mouse Orthologues:
C3ar1, C5ar1, Gpr33
Mouse Descriptions:
complement component 3a receptor 1 Gene [Source:MGI Symbol;Acc:MGI:1097680]
complement component 5a receptor 1 Gene [Source:MGI Symbol;Acc:MGI:88232]
G protein-coupled receptor 33 Gene [Source:MGI Symbol;Acc:MGI:1277106]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa7410 Missense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa7410
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059568 Missense 120 311 2 2
Genomic Location:
Chromosome 15 (position 36450098)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATAAATCTGTTTGCWAGCATTTGGTCTCTTGTAGTTATMAGTCTGGATC[G/A]ATGCCTGTGCACATGGATGGCYGTTTGGGCTCAAAACAACAGAACTCTGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/kw0fs1st