LOC566133

Ensembl ID:
ENSDARG00000053929
Human Orthologue:
OPN4
Human Description:
opsin 4 [Source:HGNC Symbol;Acc:14449]
Mouse Orthologue:
Opn4
Mouse Description:
opsin 4 (melanopsin) Gene [Source:MGI Symbol;Acc:MGI:1353425]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22105 Essential Splice Site Available for shipment Available now
sa7698 Nonsense Mutation detected in F1 DNA During 2014
sa7361 Missense Mutation detected in F1 DNA During 2014
sa22104 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa22105
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076051 Essential Splice Site 91 516 2 10
Genomic Location:
Chromosome 12 (position 27689838)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCTTCTTCACCACCAGTTTGCACAAGCGATGGATCTTTGGAGAAAAAGG[T/C]AATCCAGCTGTTAGAAAATCACGACTTGATAAAACAAATCTTTTGAAGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7698
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076051 Nonsense 95 516 3 10
Genomic Location:
Chromosome 12 (position 27679026)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACGATTTTACAGTATTTCTCATGTGTCTGTTCACAGGCTGTGAGTTATA[T/G]GCATTCTGCGGTGCTCTGTTTGGTATCTGCTCGATGATCAMACTCATGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7361
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076051 Missense 236 516 5 10
Genomic Location:
Chromosome 12 (position 27676956)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAAAATCAATGRAGAAGGAGGACCCAGAGATTCTATCAAAAAGATCCAC[C/T]GGATGAAAAACGAATGGAAGATGGCAAAGATAGCGCTCATAGTGATCCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22104
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076051 Nonsense 355 516 7 10
Genomic Location:
Chromosome 12 (position 27668126)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACGCTCCACATTGACCAGCCAGTCCTCTGAGACCAGCAGCAACTTGCAT[C/T]GAGCCGGAAAGGCACGCTTGTCCTCTGTATCTGACAGCGAATCAGTAAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/t9yz833w