LOC100331575

Ensembl ID:
ENSDARG00000053917
Human Orthologues:
ALG10, ALG10B
Human Descriptions:
asparagine-linked glycosylation 10, alpha-1,2-glucosyltransferase homolog (S. pombe) [Source:HGNC Sy
asparagine-linked glycosylation 10, alpha-1,2-glucosyltransferase homolog B (yeast) [Source:HGNC Sym
Mouse Orthologue:
Alg10b
Mouse Description:
asparagine-linked glycosylation 10 homolog B (yeast, alpha-1,2-glucosyltransferase) Gene [Source:MGI

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17701 Nonsense Available for shipment Available now
sa33485 Nonsense Mutation detected in F1 DNA During 2016
sa9255 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa17701
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076037 Nonsense 326 473 3 3
Genomic Location (Zv9):
Chromosome 4 (position 27689860)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 28390137
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAAAGAGYGGTCCGATTTTTACAGGCTTTAAAAAAGCAGCCTTTAGTTTA[T/A]TCATTKCTCATGCTGAYCTTTCTGTTTTTGATTTGGAAATTCACATTTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33485
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076037 Nonsense 395 473 3 3
Genomic Location (Zv9):
Chromosome 4 (position 27690067)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 28390344
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCGCCATGTGGAACTTTCTGGATACCTTGAGGTCCAAGTCTTTGTTTTG[G/A]TGTCTGGCGTTTTGTGCTTGTCTTGTGGCAGCTACCGTTCCTCAGAAACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9255
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076037 Nonsense 458 473 3 3
Genomic Location (Zv9):
Chromosome 4 (position 27690254)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 28390531
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTAGTCTCTATACAGCGGTAAACGCAGCTACTGTGTACATCTTCATCTAC[A/T]AAACCTTTCAGTGGCCTAACAATACGGCTGTGCAGAGATTCATGTGGTGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link