LOC100331575

Ensembl ID:
ENSDARG00000053917
Human Orthologues:
ALG10, ALG10B
Human Descriptions:
asparagine-linked glycosylation 10, alpha-1,2-glucosyltransferase homolog (S. pombe) [Source:HGNC Sy
asparagine-linked glycosylation 10, alpha-1,2-glucosyltransferase homolog B (yeast) [Source:HGNC Sym
Mouse Orthologue:
Alg10b
Mouse Description:
asparagine-linked glycosylation 10 homolog B (yeast, alpha-1,2-glucosyltransferase) Gene [Source:MGI

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17701 Nonsense Available for shipment Available now
sa9255 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa17701
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076037 Nonsense 326 473 3 3
Genomic Location:
Chromosome 4 (position 27689860)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAAAGAGYGGTCCGATTTTTACAGGCTTTAAAAAAGCAGCCTTTAGTTTA[T/A]TCATTKCTCATGCTGAYCTTTCTGTTTTTGATTTGGAAATTCACATTTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9255
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076037 Nonsense 458 473 3 3
Genomic Location:
Chromosome 4 (position 27690254)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTAGTCTCTATACAGCGGTAAACGCAGCTACTGTGTACATCTTCATCTAC[A/T]AAACCTTTCAGTGGCCTAACAATACGGCTGTGCAGAGATTCATGTGGTGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/kbymfayg