klhl26

Ensembl ID:
ENSDARG00000053876
ZFIN ID:
ZDB-GENE-030131-5975
Description:
Kelch-like protein 26 [Source:UniProtKB/Swiss-Prot;Acc:Q5RGB8]
Human Orthologue:
KLHL26
Human Description:
kelch-like 26 (Drosophila) [Source:HGNC Symbol;Acc:25623]
Mouse Orthologue:
Klhl26
Mouse Description:
kelch-like 26 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2443079]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17100 Nonsense Available for shipment Available now
sa18409 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17100
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075998 Nonsense 471 605 4 4
ENSDART00000144181 Nonsense 471 605 3 3
Genomic Location:
Chromosome 11 (position 6972833)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTGGAGGWTATGGAGTGTCTGTGGAAGATAAGAAGACTCTCCATTGCTA[T/G]GATTCAGCCTTGGATCARTGGGATTTCAAGTGTCCCATGAATGAACCTAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18409
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075998 Nonsense 546 605 4 4
ENSDART00000144181 Nonsense 546 605 3 3
Genomic Location:
Chromosome 11 (position 6973057)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAYAACTGTCAGTCCGATGCKTGCTGGTCAGTCAGAGGCTGGCTGCTGTY[T/A]GCTGGACAAAAAGATCTATATCGTTGGAGGATACAACTGGCATCTTAATA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/039y4rn8