cryba1b

Ensembl ID:
ENSDARG00000053875
ZFIN ID:
ZDB-GENE-040718-326
Description:
crystallin, beta A1b [Source:RefSeq peptide;Acc:NP_001002586]
Human Orthologue:
CRYBA1
Human Description:
crystallin, beta A1 [Source:HGNC Symbol;Acc:2394]
Mouse Orthologue:
Cryba1
Mouse Description:
crystallin, beta A1 Gene [Source:MGI Symbol;Acc:MGI:88518]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa17224 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa17224
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075992 Essential Splice Site 150 198 5 6
ENSDART00000140644 Essential Splice Site 150 198 5 6
Genomic Location:
Chromosome 21 (position 38026014)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGGGATGGTGCAACAACGAGGTCCGTTCCATCCAGGTCATGAGTGGCGC[G/A]TAAGTATGATTGCCCATATATCTATTTTATTTRAGACAAAWGAAGACAGY
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/jwguul0i