ankrd55

Ensembl ID:
ENSDARG00000053869
ZFIN ID:
ZDB-GENE-080104-7
Human Orthologue:
ANKRD55
Human Description:
ankyrin repeat domain 55 [Source:HGNC Symbol;Acc:25681]
Mouse Orthologue:
Ankrd55
Mouse Description:
ankyrin repeat domain 55 Gene [Source:MGI Symbol;Acc:MGI:1924568]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16616 Essential Splice Site Available for shipment Available now
sa18027 Essential Splice Site Available for shipment Available now
sa16758 Essential Splice Site Available for shipment Available now
sa17099 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16616
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075982 Essential Splice Site 13 650 1 11
ENSDART00000075982 Essential Splice Site 13 650 1 11
ENSDART00000075982 Essential Splice Site 13 650 1 11
Genomic Location:
Chromosome 10 (position 7837346)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGATCTRTTATGGAGTTCAACTCTTCATCTGTTTTTGAGCAGCACAAAG[G/A]TAAAACACACACACACACACACACACACACRCACACACACACACACACAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18027
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075982 Essential Splice Site 13 650 1 11
ENSDART00000075982 Essential Splice Site 13 650 1 11
ENSDART00000075982 Essential Splice Site 13 650 1 11
Genomic Location:
Chromosome 10 (position 7837346)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGATCTRTTATGGAGTTCAACTCTTCATCTGTTTTTGAGCAGCACAAAG[G/A]TAAAACACACACACACACACACACACACACRCACACACACACACACACAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16758
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075982 Essential Splice Site 13 650 1 11
ENSDART00000075982 Essential Splice Site 13 650 1 11
ENSDART00000075982 Essential Splice Site 13 650 1 11
Genomic Location:
Chromosome 10 (position 7837346)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGATCTRTTATGGAGTTCAACTCTTCATCTGTTTTTGAGCAGCACAAAG[G/A]TAAAACACACACACACACACACACACACACRCACACACACACACACACAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17099
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075982 Nonsense 621 650 11 11
Genomic Location:
Chromosome 10 (position 7814376)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAGCCCGTCGCTYGGCTCCTTCCCGACTCCAYKCACAGGAGAAYCTTTA[C/T]GAAACATTCAAGTTCTTCCTGCCATTCCTCCTCAGAGAAAACGCAGCCCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/t8nxkfee