comp

Ensembl ID:
ENSDARG00000053865
ZFIN IDs:
ZDB-GENE-060606-1, ZDB-GENE-080917-12
Human Orthologue:
COMP
Human Description:
cartilage oligomeric matrix protein [Source:HGNC Symbol;Acc:2227]
Mouse Orthologue:
Comp
Mouse Description:
cartilage oligomeric matrix protein Gene [Source:MGI Symbol;Acc:MGI:88469]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41777 Nonsense Mutation detected in F1 DNA During 2016
sa12473 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa41777
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075985 Nonsense 170 749 6 19
Genomic Location (Zv9):
Chromosome 11 (position 7047408)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 6953822
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTGGCAATTAAATGGAAACTTCTTATGCAGGTCTGCACAGACATTAAC[G/T]AGTGCGCGAATTCAAATGGAGGCTGCGTGGAGAACTCTAACTGCATCAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12473
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075985 Nonsense 430 749 13 19
Genomic Location (Zv9):
Chromosome 11 (position 7039141)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 6946093
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CYGATGTTTCATTCTCCATTCTTAGTGATGGAGATGGCYATCAGGACTCT[C/T]GAGACAACTGTCCTGCAGTTATCAATAGTTMCCAGCTGGACACRGACAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link