C14orf43 (1 of 2)

Ensembl ID:
ENSDARG00000053864
Description:
chromosome 14 open reading frame 43 [Source:HGNC Symbol;Acc:19853]
Human Orthologue:
C14orf43
Human Description:
chromosome 14 open reading frame 43 [Source:HGNC Symbol;Acc:19853]
Mouse Orthologue:
C130039O16Rik
Mouse Description:
RIKEN cDNA C130039O16 gene Gene [Source:MGI Symbol;Acc:MGI:2685106]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42979 Nonsense Mutation detected in F1 DNA During 2016
sa17472 Nonsense Available for shipment Available now
sa32166 Nonsense Mutation detected in F1 DNA During 2016
sa10714 Nonsense Available for shipment Available now
sa36476 Nonsense Mutation detected in F1 DNA During 2016
sa28897 Essential Splice Site Mutation detected in F1 DNA During 2016
sa23138 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa42979
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075978 Nonsense 204 1095 1 12
Genomic Location:
Chromosome 17 (position 37484876)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTTTCAGCAGACACAAAAGCCTGGAATGTTAAATCCACAGCAGCACGGA[C/T]AGTCCACCACTGGGAATTCTGTGCTGCAACCCTTTCAGTTAGCTTTTGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17472
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075978 Nonsense 264 1095 1 12
Genomic Location:
Chromosome 17 (position 37485056)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACAGACAAATTCTCAACAYCAACTTCAGCAACTACAGCAACAGGAGCAA[C/T]AAAAGTTAATGCTCCAACAGCGACAGCAACAGAKAGAGCAGCAGATACGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32166
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075978 Nonsense 462 1095 1 12
Genomic Location:
Chromosome 17 (position 37485650)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCGCTCCAACTGGTGTAATCCAGAGCACTCGGCGGAAGAGGAGAGTGTCA[C/T]AAGAGGCCAACCTAGAAACCCTGGCTCAGAAGGCTTCAGAAAGAGAATCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10714
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075978 Nonsense 571 1095 2 12
Genomic Location:
Chromosome 17 (position 37487716)
KASP Assay ID:
2261-1369.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGSCTYCTGACATGAGYTGCTCCAATTACCAGCCCTCTGTGATTGTTACA[C/T]GACGGCGCTCGCTGAGGAACTCCCCATCTGAGAGCACRGGCCAGGTGAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36476
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075978 Nonsense 599 1095 3 12
Genomic Location:
Chromosome 17 (position 37490514)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTTCTGCAGAATGGCGGAGCAGAGAGCGGGAGTGAAGCTGACAGCAAAT[C/A]AGCCAAAGCCAAACGACGTCCTCGTCCAGAACCGCTCTTTATCCCCCCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28897
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075978 Essential Splice Site 811 1095 7 12
Genomic Location:
Chromosome 17 (position 37510462)
KASP Assay ID:
2261-1370.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCCTCAGCCATACTTAATTCTTTTTCCTTTCCTTTTTTTTTTCTTCACA[G/A]GGAACCCTCACACATCTGCTATTAAAAAAAAACATCTTTTCCAAATCGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23138
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075978 Nonsense 1007 1095 11 12
Genomic Location:
Chromosome 17 (position 37520615)
KASP Assay ID:
2261-1371.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTCCGACACTGCTGCCAGGAAAACTGGGCCCAGCAACACAGGAAAGGGA[C/T]AAACCAACCAAGAGGGCGAATTCCCCTGCAAGAAGTGTGGCAGGTCAGTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link