ism2

Ensembl ID:
ENSDARG00000053859
ZFIN ID:
ZDB-GENE-050523-4
Description:
Isthmin-2 [Source:UniProtKB/Swiss-Prot;Acc:Q58T08]
Human Orthologue:
ISM2
Human Description:
isthmin 2 homolog (zebrafish) [Source:HGNC Symbol;Acc:23176]
Mouse Orthologue:
Ism2
Mouse Description:
isthmin 2 homolog (zebrafish) Gene [Source:MGI Symbol;Acc:MGI:2685110]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa23633 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa23633
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075974 Essential Splice Site 266 437 6 6
Genomic Location (Zv9):
Chromosome 20 (position 5342705)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 5258298
KASP Assay ID:
2261-3934.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATGCTATTTAGAGTACATACTATGATTAATGTGGATTCGGTTGTTCTGC[A/T]GATGTGGACAGCTGTGAGAAGTGGTTGAACTGTAAGAGTGAGTTCCTTCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link