rab11fip4a

Ensembl ID:
ENSDARG00000053855
ZFIN ID:
ZDB-GENE-040718-266
Description:
Rab11 family-interacting protein 4A [Source:UniProtKB/Swiss-Prot;Acc:Q3LGD4]
Human Orthologue:
RAB11FIP4
Human Description:
RAB11 family interacting protein 4 (class II) [Source:HGNC Symbol;Acc:30267]
Mouse Orthologue:
Rab11fip4
Mouse Description:
RAB11 family interacting protein 4 (class II) Gene [Source:MGI Symbol;Acc:MGI:2442920]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa38406 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa38406
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075960 Nonsense 419 515 11 13
Genomic Location (Zv9):
Chromosome 3 (position 44277399)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 35897138
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACGTACTGCTGCTGGACTGTCTGAATACAACGCCAAGACTCGAGAGATC[G/T]AACTGGAGCATGAAGTAAAAAGGCTTAAGCAGGTACAGCAGACAGATATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link