si:ch211-284o19.8

Ensembl ID:
ENSDARG00000053836
ZFIN ID:
ZDB-GENE-070912-289
Human Orthologue:
GRINA
Human Description:
glutamate receptor, ionotropic, N-methyl D-aspartate-associated protein 1 (glutamate binding) [Sourc
Mouse Orthologue:
Grina
Mouse Description:
glutamate receptor, ionotropic, N-methyl D-aspartate-associated protein 1 (glutamate binding) Gene [

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa11078 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa11078
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075947 Essential Splice Site 159 300 3 6
ENSDART00000141447 Essential Splice Site 159 300 4 7
ENSDART00000145711 Essential Splice Site 29 135 1 4
Genomic Location (Zv9):
Chromosome 2 (position 37597048)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 37876180
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CRGTGTCCTCCACGTTCAGTCGCAAACATCCCTGGAATCTGGTGGGACTG[G/A]TGAGTGTTTGGRTTAACATAAGAATATGAATGTTTRTGTCATGGTATAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link