plekhh1

Ensembl ID:
ENSDARG00000053835
ZFIN ID:
ZDB-GENE-061219-1
Description:
Pleckstrin homology domain-containing family H member 1 [Source:UniProtKB/Swiss-Prot;Acc:Q00IB7]
Human Orthologue:
PLEKHH1
Human Description:
pleckstrin homology domain containing, family H (with MyTH4 domain) member 1 [Source:HGNC Symbol;Acc
Mouse Orthologue:
Plekhh1
Mouse Description:
pleckstrin homology domain containing, family H (with MyTH4 domain) member 1 Gene [Source:MGI Symbol

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39172 Splice Site, Nonsense Mutation detected in F1 DNA During 2017
sa11978 Essential Splice Site Available for shipment Available now
sa28898 Nonsense Mutation detected in F1 DNA During 2017
sa9622 Essential Splice Site Available for shipment Available now
sa23139 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa39172
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075941 Splice Site, Nonsense 69 1432 3 30
Genomic Location (Zv9):
Chromosome 17 (position 38133493)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 38018390
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGAACAGAGAGTCATAGAGGCTGACCAGAGAGCAGAGAGCGCCGAAAAG[C/T]AGGTATTGCTATTGAAAACAATGTTGTCTCTTTCAGAATTCATCTGTATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11978
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075941 Essential Splice Site 760 1432 15 30
Genomic Location (Zv9):
Chromosome 17 (position 38153646)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 38038543
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCCATGGATAAAGAAGTCAAGCCTACAGCGCKAGGCTGGTTAAYAAAGG[T/C]AAGAGTTCACWKGAGTGTTAACAATGYRCTCCATTATTTCGTTTCAAGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28898
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075941 Nonsense 782 1432 16 30
Genomic Location (Zv9):
Chromosome 17 (position 38159138)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 38044035
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTCAAAGCTTGTGTGGTGTGCCTTAATTGGGAAAGTCTTTTACTACTAC[C/T]GAAACCAAGAAGACAAGGTGAATATCTTCACATTTCTGAATTAAAAGCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9622
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075941 Essential Splice Site 787 1432 16 30
Genomic Location (Zv9):
Chromosome 17 (position 38159156)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 38044053
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGCCTTAATTGGGAAAGTCKTTTACTACTACCGAAACCAAGAAGACAAG[G/A]TGAATATCTTYACWTTTCTGAATTAAAAGCTTTTCAAAGTTTTMATTAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23139
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075941 Nonsense 1370 1432 29 30
Genomic Location (Zv9):
Chromosome 17 (position 38187095)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 38071992
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCAGGCTTTGGGCAAAAAGACTGTGGATAAACTTCTATTTGCAATGGCT[A/T]AACCAAAGGTAAGACGTGATGTTACAAAAGGTAAAACAGAGTTTAACAGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Sphingolipid levels: Genome-wide association study identifies novel loci associated with circulating phospho- and sphingolipid concentrations. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link