itm1

Ensembl ID:
ENSDARG00000053832
ZFIN ID:
ZDB-GENE-021015-3
Description:
integral membrane protein 1 [Source:RefSeq peptide;Acc:NP_958866]
Human Orthologue:
STT3A
Human Description:
STT3, subunit of the oligosaccharyltransferase complex, homolog A (S. cerevisiae) [Source:HGNC Symbo
Mouse Orthologue:
Stt3a
Mouse Description:
STT3, subunit of the oligosaccharyltransferase complex, homolog A (S. cerevisiae) Gene [Source:MGI S

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21794 Essential Splice Site Mutation detected in F1 DNA During 2016
sa17071 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21794
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075928 Essential Splice Site 50 702 2 16
Genomic Location (Zv9):
Chromosome 10 (position 40603640)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 39292339
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGACTGTTTTCTGTGCTTCGGTTCGAGAGCGTCATCCACGAGTTTGATCC[G/T]TGAGTACCGCTTTAGAGTCCACGGTTTGGTGCACTAGTATCCAAACTTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17071
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075928 Nonsense 400 702 10 16
Genomic Location (Zv9):
Chromosome 10 (position 40592104)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 39303875
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGATGCCACGATTTTCATCATCATGTATGGCGTCACCAGCATGTACTTCK[C/A]AGCWGTGATGGTAAAATATTTCCACTTYCTCTTTRAAGTAGATKCATTGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link