itm1

Ensembl ID:
ENSDARG00000053832
ZFIN ID:
ZDB-GENE-021015-3
Description:
integral membrane protein 1 [Source:RefSeq peptide;Acc:NP_958866]
Human Orthologue:
STT3A
Human Description:
STT3, subunit of the oligosaccharyltransferase complex, homolog A (S. cerevisiae) [Source:HGNC Symbo
Mouse Orthologue:
Stt3a
Mouse Description:
STT3, subunit of the oligosaccharyltransferase complex, homolog A (S. cerevisiae) Gene [Source:MGI S

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21794 Essential Splice Site Mutation detected in F1 DNA During 2014
sa4390 Nonsense Mutation detected in F1 DNA During 2014
sa17071 Nonsense Available for shipment Available now
sa7651 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa21794
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075928 Essential Splice Site 50 702 2 16
Genomic Location:
Chromosome 10 (position 40603640)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGACTGTTTTCTGTGCTTCGGTTCGAGAGCGTCATCCACGAGTTTGATCC[G/T]TGAGTACCGCTTTAGAGTCCACGGTTTGGTGCACTAGTATCCAAACTTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4390
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075928 Nonsense 189 702 6 16
Genomic Location:
Chromosome 10 (position 40598108)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATTTTCTGCATGCTGYTGACGTACTACATGTGGATCAAGGCAGTGAAGT[C/A]GGGCTCCATTTATTGGTCATCCATGTGTGCAYTGGCATATTTTTACATGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17071
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075928 Nonsense 400 702 10 16
Genomic Location:
Chromosome 10 (position 40592104)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGATGCCACGATTTTCATCATCATGTATGGCGTCACCAGCATGTACTTCK[C/A]AGCWGTGATGGTAAAATATTTCCACTTYCTCTTTRAAGTAGATKCATTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7651
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075928 Nonsense 585 702 14 16
Genomic Location:
Chromosome 10 (position 40586376)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATTATGCGAGAGCTGGATGTGAGCTACGTCCTGGTGATCTTTGGCGGAT[T/A]GACCGGATATTCATCTGATGGTAYGGGATGTTTTTTTATTTTTTATTTAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/m9tyftwv