si:ch211-218m3.19

Ensembl ID:
ENSDARG00000053817
ZFIN ID:
ZDB-GENE-091116-93

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37370 Nonsense Mutation detected in F1 DNA During 2017
sa43712 Nonsense Mutation detected in F1 DNA During 2017
sa24022 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa37370
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099864 Nonsense 25 315 1 2
ENSDART00000132774 Nonsense 25 314 1 1
Genomic Location (Zv9):
Chromosome 21 (position 39144133)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 40284198
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACAGCATTCTTCTAGTGGAGGGATTCAGAGTTACACCTCAGTCCACCTA[T/A]CCTGTCTTCATTCTTCTTCTCCTGGCTTATGTTTTTACAATGGTCTCCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43712
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099864 Nonsense 44 315 1 2
ENSDART00000132774 Nonsense 44 314 1 1
Genomic Location (Zv9):
Chromosome 21 (position 39144188)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 40284253
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTTCATTCTTCTTCTCCTGGCTTATGTTTTTACAATGGTCTCCAACATC[G/T]GACTTATAGTTCTAATATCGACTGAGAAGAATCTTCATCATCCTATGCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24022
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099864 Nonsense 151 315 1 2
ENSDART00000132774 Nonsense 151 314 1 1
Genomic Location (Zv9):
Chromosome 21 (position 39144511)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 40284576
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCGGCTATAATGACCAATAAGATGGTTATTAAGCTCTCAGCATCAGCCTG[G/A]GGGTTGGCTATTCTTCTTGTGACAATTATGTTAGGCCTGACTATACGCCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link