si:ch211-89o10.1

Ensembl ID:
ENSDARG00000053804
ZFIN ID:
ZDB-GENE-091116-46
Human Orthologue:
OSBPL1A
Human Description:
oxysterol binding protein-like 1A [Source:HGNC Symbol;Acc:16398]
Mouse Orthologue:
Osbpl1a
Mouse Description:
oxysterol binding protein-like 1A Gene [Source:MGI Symbol;Acc:MGI:1927551]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37753 Nonsense Mutation detected in F1 DNA During 2017
sa37752 Nonsense Available for shipment Available now
sa44019 Nonsense Mutation detected in F1 DNA During 2017
sa37751 Essential Splice Site Mutation detected in F1 DNA During 2017
sa37750 Essential Splice Site Mutation detected in F1 DNA During 2017
sa3220 Nonsense F2 line generated During 2017

Mutation Details

Allele Name:
sa37753
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053614 Nonsense 34 467 2 13
ENSDART00000142661 Nonsense 34 467 3 14
Genomic Location (Zv9):
Chromosome 23 (position 31190405)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 31025295
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGACTCGTGTGAAGTCAGCTTTAAAGATGCCTGCGTTTATGCTAACAAA[C/T]AGACGGCGAATGGCAAAGTGCCATCTGAGAATGGAGTATGGGAGAGGCGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37752
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053614 Nonsense 216 467 7 13
ENSDART00000142661 Nonsense 216 467 8 14
Genomic Location (Zv9):
Chromosome 23 (position 31183508)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 31018398
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTAAAAAGTGAGACCTTGTTTTAAAATTTGTTATTTTTTATTTCAGGCAC[A/T]GAGAAGCTTACACTTGGACAAACCCCATGTGTTGTGTGCATAATGTTATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44019
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053614 Nonsense 255 467 8 13
ENSDART00000142661 Nonsense 255 467 9 14
Genomic Location (Zv9):
Chromosome 23 (position 31183255)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 31018145
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATGCAGCGAATGGTGTCTTCTCTATTCATTTTAGCACTGGGGACAAGTG[T/A]GTGCTGAATTTTAAGCCATGTGGCATGTTTGGCAAAGAGCTGCATCGGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37751
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053614 Essential Splice Site 362 467 10 13
ENSDART00000142661 Essential Splice Site 362 467 11 14
Genomic Location (Zv9):
Chromosome 23 (position 31180999)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 31015889
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGTAAACTGCTTTGGAGAGTTGCACCTCGACCACCACAATCCACAGAGG[T/A]AAACTCAAGCCTTTAGACTTCAGAAAAACATGGCATTAACATCCGTCTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37750
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053614 Essential Splice Site 434 467 12 13
ENSDART00000142661 Essential Splice Site 434 467 13 14
Genomic Location (Zv9):
Chromosome 23 (position 31178948)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 31013838
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGCGGCTAGAAGAGAGCGTGCTAAAGATGAAGAAGACTGGTCTACAAGG[T/C]AAGCGTTATGTTAAGAGCTGTTTATCCACATCTGTGCATTTTGGCATATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3220
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053614 Nonsense 435 467 13 13
ENSDART00000142661 Nonsense 435 467 14 14
Genomic Location (Zv9):
Chromosome 23 (position 31176435)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 31011325
KASP Assay ID:
554-2776.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGAGTTKAGTTTTAGATTCTTAACTWTTTTGGCCTCCTGTTTTCAGATG[G/A]TTCCAGCAAGGCAATAATCCGTACACTGGAACCGCAGACTGGATCTACAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Osteoporosis: An integration of genome-wide association study and gene expression profiling to prioritize the discovery of novel susceptibility Loci for osteoporosis-related traits. (View Study)
  • Protein quantitative trait loci: A genome-wide association study identifies protein quantitative trait loci (pQTLs). (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link