si:ch211-218m3.13

Ensembl ID:
ENSDARG00000053779
ZFIN ID:
ZDB-GENE-091113-55

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43710 Nonsense Mutation detected in F1 DNA During 2017
sa13205 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa43710
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112449 Nonsense 220 313 1 2
ENSDART00000144436 Nonsense 220 313 1 1
Genomic Location (Zv9):
Chromosome 21 (position 39113898)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 40253963
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGTGGTTGCACTCAGTCTGTCAGCATTATCTATATTTGTAACGTATGTC[A/T]AAATTGCTACTGTATGTATAACCAGCAAGAACAAAGCACTCAACAGCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13205
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112449 Nonsense 296 313 1 2
ENSDART00000144436 Nonsense 296 313 1 1
Genomic Location (Zv9):
Chromosome 21 (position 39114126)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 40254191
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACATTGTACCACCAGGTTTGAATCCCTTAGTATATGGTTTGCAAACCAAA[G/T]AGATTAGAGAAAAGGTTGTGAAACTCTGGTGYAGAAAGAAGATAATGATA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link