APBB3

Ensembl ID:
ENSDARG00000053771
Description:
amyloid beta (A4) precursor protein-binding, family B, member 3 [Source:HGNC Symbol;Acc:20708]
Human Orthologue:
APBB3
Human Description:
amyloid beta (A4) precursor protein-binding, family B, member 3 [Source:HGNC Symbol;Acc:20708]
Mouse Orthologue:
Apbb3
Mouse Description:
amyloid beta (A4) precursor protein-binding, family B, member 3 Gene [Source:MGI Symbol;Acc:MGI:1084

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18391 Nonsense Available for shipment Available now
sa18589 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa18391
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075808 Nonsense 72 480 2 12
Genomic Location (Zv9):
Chromosome 21 (position 39413705)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 40742167
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTGGCAGCATCCCTCCTACAGCGCAGAGGAGGAGCAGAACGCCATTAAC[G/T]GAGTCACTGCCAGCCAGATCMAGGTGAGATGCTCTCNNNTCTCTNNNNGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18589
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075808 Essential Splice Site 406 480 11 12
Genomic Location (Zv9):
Chromosome 21 (position 39379948)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 40708410
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGAGCCCGATGCCGGGATCATCTCYGAGGCAGTCCARGCTGCATGCATG[G/A]TGAGCTGATACTACATTTATTTGAYTTYCACAYTAYAGAACTGGTAAAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link