APBB3

Ensembl ID:
ENSDARG00000053771
Description:
amyloid beta (A4) precursor protein-binding, family B, member 3 [Source:HGNC Symbol;Acc:20708]
Human Orthologue:
APBB3
Human Description:
amyloid beta (A4) precursor protein-binding, family B, member 3 [Source:HGNC Symbol;Acc:20708]
Mouse Orthologue:
Apbb3
Mouse Description:
amyloid beta (A4) precursor protein-binding, family B, member 3 Gene [Source:MGI Symbol;Acc:MGI:1084

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18391 Nonsense Available for shipment Available now
sa18589 Essential Splice Site Available for shipment Available now
sa4966 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa18391
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075808 Nonsense 72 480 2 12
Genomic Location:
Chromosome 21 (position 39413705)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTGGCAGCATCCCTCCTACAGCGCAGAGGAGGAGCAGAACGCCATTAAC[G/T]GAGTCACTGCCAGCCAGATCMAGGTGAGATGCTCTCNNNTCTCTNNNNGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18589
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075808 Essential Splice Site 406 480 11 12
Genomic Location:
Chromosome 21 (position 39379948)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGAGCCCGATGCCGGGATCATCTCYGAGGCAGTCCARGCTGCATGCATG[G/A]TGAGCTGATACTACATTTATTTGAYTTYCACAYTAYAGAACTGGTAAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4966
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075808 Nonsense 445 480 12 12
Genomic Location:
Chromosome 21 (position 39379712)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTCCAAAGTCAAACGAGCCAACTCCATGGATGGCTCCAGTTTCCCACCA[C/T]GATATCAAGGACACACAGCCTCCAAAATGACCTCTCCCAGTGTGAAGAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/bmryp3s4