mff

Ensembl ID:
ENSDARG00000053753
ZFIN ID:
ZDB-GENE-040426-1510
Description:
Mitochondrial fission factor homolog B [Source:UniProtKB/Swiss-Prot;Acc:Q7SZQ4]
Human Orthologue:
MFF
Human Description:
mitochondrial fission factor [Source:HGNC Symbol;Acc:24858]
Mouse Orthologue:
Mff
Mouse Description:
mitochondrial fission factor Gene [Source:MGI Symbol;Acc:MGI:1922984]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32055 Nonsense Mutation detected in F1 DNA During 2016
sa17105 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa32055
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059195 Nonsense 98 230 3 6
ENSDART00000126237 Nonsense 98 303 2 7
ENSDART00000131479   None 110 None 4
ENSDART00000144153 Nonsense 139 344 3 8
Genomic Location (Zv9):
Chromosome 15 (position 34543522)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 35389298
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGATCTGGACCTCATCCAGTCCACCCCACAGGAGTCCACACTGTCTCTC[A/T]AGACGCCGCCTCGGGTCCTTACGCTCAGCGATCGTCCCCTCGACTTCCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17105
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059195 Nonsense 187 230 5 6
ENSDART00000126237 Nonsense 260 303 6 7
ENSDART00000131479 Nonsense 67 110 3 4
ENSDART00000144153 Nonsense 301 344 7 8
Genomic Location (Zv9):
Chromosome 15 (position 34527702)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 35373478
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGGAGGAACRGATGACATGGCTGTTGTGGACGCAACCTCTCTAYGCAGA[C/T]AGGTATTAWTTTGCTGTTATATATACATACATACATATATAYATACAGTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link