dcdc2b

Ensembl ID:
ENSDARG00000053744
ZFIN ID:
ZDB-GENE-051113-124
Description:
doublecortin domain-containing protein 2 [Source:RefSeq peptide;Acc:NP_001032778]
Human Orthologue:
DCDC2B
Human Description:
doublecortin domain containing 2B [Source:HGNC Symbol;Acc:32576]
Mouse Orthologue:
Dcdc2b
Mouse Description:
doublecortin domain containing 2b Gene [Source:MGI Symbol;Acc:MGI:2686212]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42243 Essential Splice Site Mutation detected in F1 DNA During 2017
sa1463 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa42243
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075826 Essential Splice Site 108 447 4 14
ENSDART00000145295 Essential Splice Site 108 153 4 6
Genomic Location (Zv9):
Chromosome 13 (position 33530907)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 33176855
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTTAGTTATCTGAGCGCAGGACTGAAGAAAGCTGTTGAACCAACCCAG[G/A]TATATCCGTGACAATTCAGTGCTCGTTACTTTTTTATTTGTGACTTTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1463
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075826 Essential Splice Site 396 447 12 14
ENSDART00000145295   None 153 None 6
Genomic Location (Zv9):
Chromosome 13 (position 33536470)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 33182418
KASP Assay ID:
554-1388.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAACACCACAGGAACACACACCTCCGCATGAGACAAACAAATATGAGAGC[G/A]TAAGATTATGCACGTTGGACAACAGCTTTTATATTCTAATCTAATACAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link