ENSDARG00000053731

Ensembl ID:
ENSDARG00000053731

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17443 Nonsense Available for shipment Available now
sa14143 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa17443
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075814 Nonsense 7 252 1 7
Genomic Location:
Chromosome 1 (position 25540641)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATATTTCTTGTGCTCTTCTGTGWCGCAGACTTGTATCTGAAGGGCCCAT[T/A]GCTGGGACGACGTGGATTTGGCTCTGTGTTTGCTGGGGTCCGCAGGTCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14143
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075814 Essential Splice Site 164 252 5 7
Genomic Location:
Chromosome 1 (position 25539983)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCGGCTGTGGAGATCTGCWGAAGCACTCGGCCTACAAATACTTTGAAGG[T/C]GGGTTTGAGTTACAGAAGGAAACGTTCTGTTTATTATTGTGAACGTCTAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/cijactr4