ttll3

Ensembl ID:
ENSDARG00000053728
ZFIN ID:
ZDB-GENE-060616-182
Description:
Tubulin monoglycylase TTLL3 [Source:UniProtKB/Swiss-Prot;Acc:Q1ECV4]
Human Orthologues:
RP11-266J6.1, TTLL3
Human Descriptions:
ARPC4-TTLL3 fusion protein [Source:RefSeq peptide;Acc:NP_001185722]
tubulin tyrosine ligase-like family, member 3 [Source:HGNC Symbol;Acc:24483]
Mouse Orthologue:
Ttll3
Mouse Description:
tubulin tyrosine ligase-like family, member 3 Gene [Source:MGI Symbol;Acc:MGI:2141418]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40756 Essential Splice Site Mutation detected in F1 DNA During 2016
sa8240 Nonsense Mutation detected in F1 DNA During 2016
sa15000 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa40756
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103992 Essential Splice Site 115 771 5 13
ENSDART00000130665 Essential Splice Site 133 789 5 13
Genomic Location:
Chromosome 6 (position 40278273)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAGGAGGTCGAGAGGGATGATGAAGCAGAGGATCTGTATGACCTAATGG[T/C]ATGTTTAGACTGTAAAATCCCATTCTAATGACAGTTGAACATTAATCTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8240
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103992 Nonsense 635 771 13 13
ENSDART00000130665 Nonsense 653 789 13 13
Genomic Location:
Chromosome 6 (position 40260642)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCACAAGTCCTYGCTCTTAAGCAGCCCCTGCACTTCTGGCAAGGAAAAT[C/T]AGTCAGAAGAGRTGAAAAGGGCCTGTCCTAACCTTCCCAACCGTAAAATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15000
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103992 Nonsense 688 771 13 13
ENSDART00000130665 Nonsense 706 789 13 13
Genomic Location:
Chromosome 6 (position 40260483)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACCTTCAACCTGTTGCRTTCTTCCAAACCCAACAGAACTTCATCATCCA[C/T]AAAGACTATCCCACACTCAGCCCCAATCAGATYGCCCTCACACACACAGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link