ttll3

Ensembl ID:
ENSDARG00000053728
ZFIN ID:
ZDB-GENE-060616-182
Description:
Tubulin monoglycylase TTLL3 [Source:UniProtKB/Swiss-Prot;Acc:Q1ECV4]
Human Orthologues:
RP11-266J6.1, TTLL3
Human Descriptions:
ARPC4-TTLL3 fusion protein [Source:RefSeq peptide;Acc:NP_001185722]
tubulin tyrosine ligase-like family, member 3 [Source:HGNC Symbol;Acc:24483]
Mouse Orthologue:
Ttll3
Mouse Description:
tubulin tyrosine ligase-like family, member 3 Gene [Source:MGI Symbol;Acc:MGI:2141418]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8240 Nonsense Mutation detected in F1 DNA During 2014
sa15000 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa8240
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103992 Nonsense 635 771 13 13
ENSDART00000130665 Nonsense 653 789 13 13
Genomic Location:
Chromosome 6 (position 40260642)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCACAAGTCCTYGCTCTTAAGCAGCCCCTGCACTTCTGGCAAGGAAAAT[C/T]AGTCAGAAGAGRTGAAAAGGGCCTGTCCTAACCTTCCCAACCGTAAAATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15000
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103992 Nonsense 688 771 13 13
ENSDART00000130665 Nonsense 706 789 13 13
Genomic Location:
Chromosome 6 (position 40260483)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACCTTCAACCTGTTGCRTTCTTCCAAACCCAACAGAACTTCATCATCCA[C/T]AAAGACTATCCCACACTCAGCCCCAATCAGATYGCCCTCACACACACAGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/is7rm4ed