LOC555473

Ensembl ID:
ENSDARG00000053724
Human Orthologue:
ADCYAP1R1
Human Description:
adenylate cyclase activating polypeptide 1 (pituitary) receptor type I [Source:HGNC Symbol;Acc:242]
Mouse Orthologue:
Adcyap1r1
Mouse Description:
adenylate cyclase activating polypeptide 1 receptor 1 Gene [Source:MGI Symbol;Acc:MGI:108449]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa40722 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa40722
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075790 Nonsense 32 445 2 13
Genomic Location (Zv9):
Chromosome 6 (position 32688664)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 33006329
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTACATTTTGTTTTAGATCTACTGCATGCATCCAGACTGTGTCATTCAGT[T/A]AGAGAAGGAGAAGTGTATTGAAAGGATGTTCCTGGATGATCCCAACAGTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Major depressive disorder: Genome-wide association analysis of gender differences in major depressive disorder in the Netherlands NESDA and NTR population-based samples. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link