Q6DG47_DANRE

Ensembl ID:
ENSDARG00000053713
Description:
LOC553231 protein [Source:UniProtKB/TrEMBL;Acc:Q6DG47]
Human Orthologue:
CCDC88C
Human Description:
coiled-coil domain containing 88C [Source:HGNC Symbol;Acc:19967]
Mouse Orthologue:
Ccdc88c
Mouse Description:
coiled-coil domain containing 88C Gene [Source:MGI Symbol;Acc:MGI:1915589]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2919 Splice Site, Nonsense F2 line generated During 2017
sa5633 Nonsense F2 line generated During 2017
sa23144 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa2919
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062010 Splice Site, Nonsense 555 1997 14 30
Genomic Location (Zv9):
Chromosome 17 (position 38827346)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 38712243
KASP Assay ID:
554-3145.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACAGAGAATGGAGAAAACTTTGGAGACAATYCAGGCAGAGAAAGAYAGA[C/T]AGGTGAACATCWAAAGAAAGAMAAGTAAACCCATGATGATWAGGGKTATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5633
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062010 Nonsense 1429 1997 25 30
ENSDART00000062010 Nonsense 1429 1997 25 30
Genomic Location (Zv9):
Chromosome 17 (position 38856355)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 38741252
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATTCATYAAACCCAAGAAAGAAAGTTCACGAGAGAGACCAGACGCTCCA[C/T]GAGAAAGRATTMGAAGTGCTCCAGACATYCCTCTTCCGGAGATCCCCWCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23144
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062010 Essential Splice Site 1615 1997 29 30
Genomic Location (Zv9):
Chromosome 17 (position 38875403)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 38760300
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGGCATCTCACACTGTACAGCTCATGGTTTATTCTCCTGTTTTCCTCCA[G/A]GGTCTCTGGATTGTCTGCAGGGCCGATCTGCCAGTCTGTCCAGTGATGAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link