LOC100334697

Ensembl ID:
ENSDARG00000053709
Human Orthologues:
ACHE, BCHE
Human Descriptions:
acetylcholinesterase [Source:HGNC Symbol;Acc:108]
butyrylcholinesterase [Source:HGNC Symbol;Acc:983]
Mouse Orthologues:
Ache, Bche
Mouse Descriptions:
acetylcholinesterase Gene [Source:MGI Symbol;Acc:MGI:87876]
butyrylcholinesterase Gene [Source:MGI Symbol;Acc:MGI:894278]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40201 Nonsense Mutation detected in F1 DNA During 2017
sa44580 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa40201
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075788 Nonsense 23 576 1 8
Genomic Location (Zv9):
Chromosome 4 (position 2128687)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 2418394
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGTGTTGAGTTTGTGTGTGTTTTTCCTCACTGACTCCAGATCAGATGCT[C/T]AGATCAATGTATCTGCTGTACTGCGCAGTGTTTCTCCATCAGCACTGACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44580
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075788 Essential Splice Site 189 576 2 8
Genomic Location (Zv9):
Chromosome 4 (position 2130958)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATCAGCAACTACACACAGACGGTGATCGTGAGCATCGCATATCGCCTGG[G/A]TGAGTCACAAACTGACCATAATAATCATAACCAGGGGTTTGATTTATTAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link