LOC792410

Ensembl ID:
ENSDARG00000053708
Human Orthologue:
GHRHR
Human Description:
growth hormone releasing hormone receptor [Source:HGNC Symbol;Acc:4266]
Mouse Orthologue:
Ghrhr
Mouse Description:
growth hormone releasing hormone receptor Gene [Source:MGI Symbol;Acc:MGI:95710]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25340 Splice Site, Nonsense Mutation detected in F1 DNA During 2014
sa2337 Nonsense Mutation detected in F1 DNA During 2014
sa18844 Nonsense Mutation detected in F1 DNA During 2014
sa1606 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa25340
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075780 Splice Site, Nonsense 261 453 7 13
Genomic Location:
Chromosome 6 (position 32651662)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACTTTTGTCTCACAGAAGAAGTATTTCTGGTGGTATATACTTATTGGCT[G/A]GGGTAAGTTCAGTGCTTGAAAACGTATTGTTATATAATATACAATGGTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2337
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075780 Nonsense 406 453 13 13
ENSDART00000075780 Nonsense 406 453 13 13
Genomic Location:
Chromosome 6 (position 32658065)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTGTTTGTTTCAGGTACAAGCAGAGCTGAAGAAGAGACTGTGGAAGTGG[C/T]AAACACAAAGTTATTTGAGATACAGTAAGAGAAGAYGAACCCTCTTTAYA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18844
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075780 Nonsense 406 453 13 13
ENSDART00000075780 Nonsense 406 453 13 13
Genomic Location:
Chromosome 6 (position 32658065)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTGTTTGTTTCAGGTACAAGCAGAGCTGAAGAAGAGACTGTGGAAGTGG[C/T]AAACACAAAGTTATTTGAGATACAGTAAGAGAAGACGAACCCTCTTTACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1606
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075780 Nonsense 418 453 13 13
Genomic Location:
Chromosome 6 (position 32658101)
KASP Assay ID:
554-1547.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACTGTGGAAGTGGCAAACACAAAGTTATTTGAGATACAGTAAGAGAAGA[C/T]GAACCCTCTTTAYAGAGAGCAGYACAGTCACACAAATCTCCGTTTTAGAG
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ais32k5n