il2rgb

Ensembl ID:
ENSDARG00000053702
ZFIN ID:
ZDB-GENE-080402-2
Description:
interleukin 2 receptor, gamma b [Source:RefSeq peptide;Acc:NP_001116522]
Human Orthologue:
IL2RG
Human Description:
interleukin 2 receptor, gamma [Source:HGNC Symbol;Acc:6010]
Mouse Orthologue:
Il2rg
Mouse Description:
interleukin 2 receptor, gamma chain Gene [Source:MGI Symbol;Acc:MGI:96551]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa1739 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa1739
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105780 Nonsense 3 385 1 8
Genomic Location:
Chromosome 14 (position 31837155)
KASP Assay ID:
554-1684.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAGACCACAGTCATTTGTCACTCAGACGCTCAGAAGAGAGCATGACTTA[C/A]ATTCACACATCCAGACTGTATTTTAGGCTGCTGTTTTTAATTTTGTGCTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/wsh6l2gh