maea

Ensembl ID:
ENSDARG00000053691
ZFIN ID:
ZDB-GENE-030131-294
Description:
Macrophage erythroblast attacher [Source:UniProtKB/Swiss-Prot;Acc:Q7SXR3]
Human Orthologue:
MAEA
Human Description:
macrophage erythroblast attacher [Source:HGNC Symbol;Acc:13731]
Mouse Orthologue:
Maea
Mouse Description:
macrophage erythroblast attacher Gene [Source:MGI Symbol;Acc:MGI:1891748]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa14746 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa14746
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075759 Essential Splice Site 152 396 3 9
Genomic Location:
Chromosome 14 (position 22133337)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGGCTATTACAACACTGCTGTCAAGCTAGCCAGGCAAAGCGGAATTGAGG[T/C]TCGTTGGCTTTAKCTGCAATGTTGGCTAAATACTAGCGCTGTCTCTTATA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/h01dlx7m