LOC100333073

Ensembl ID:
ENSDARG00000053678
Human Orthologue:
SLC4A3
Human Description:
solute carrier family 4, anion exchanger, member 3 [Source:HGNC Symbol;Acc:11029]
Mouse Orthologue:
Slc4a3
Mouse Description:
solute carrier family 4 (anion exchanger), member 3 Gene [Source:MGI Symbol;Acc:MGI:109350]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34759 Nonsense Mutation detected in F1 DNA During 2017
sa34758 Nonsense Mutation detected in F1 DNA During 2017
sa41548 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa34759
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075745 Nonsense 41 1172 2 23
Genomic Location (Zv9):
Chromosome 9 (position 47251726)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 46803373
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAAGTACATTAACATCATGCTGATTTTAACCTGTCTTTGTTTTCTCAGA[T/G]CACCGGCACACCTTCCACCATACCCACCACCCCCTGTCCACACATCTTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34758
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075745 Nonsense 123 1172 2 23
Genomic Location (Zv9):
Chromosome 9 (position 47251482)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 46803617
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGGGCAGTGTCAAGCAGCCACACCTACTGAGCCATCTGAAGAGCTGCCA[C/T]AGGTAACCTGAAAGAAAATATCATACTACTGTTTAGGGCAGAAAGTGCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41548
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075745 Nonsense 472 1172 11 23
Genomic Location (Zv9):
Chromosome 9 (position 47198612)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 46856487
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGTTTGTGTGGTTTGTGATTTTTACCGCAGTAAATGTGTTTATAGGGTG[T/A]GTGGAGTTCCTAGAGAAGCCTGCGATGGCCTTTGTCCGGCTGAACGAGTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link