cmyb

Ensembl ID:
ENSDARG00000053666
ZFIN ID:
ZDB-GENE-991110-14
Description:
transcriptional activator Myb [Source:RefSeq peptide;Acc:NP_571341]
Human Orthologue:
MYB
Human Description:
v-myb myeloblastosis viral oncogene homolog (avian) [Source:HGNC Symbol;Acc:7545]
Mouse Orthologue:
Myb
Mouse Description:
myeloblastosis oncogene Gene [Source:MGI Symbol;Acc:MGI:97249]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32456 Nonsense Available for shipment Available now
sa32457 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa32456
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075726 Nonsense 280 590 8 15
ENSDART00000075730 Nonsense 280 641 8 16
Genomic Location (Zv9):
Chromosome 23 (position 32060276)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 31895166
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTTACTTTGCTCTCATCTCACATAGAGACACTACAGCGACGAGGACCCC[G/T]AAAAAGAAAAGAGGGTGAAAGAAATCGAGATGCTGTTGATGTCAACAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32457
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075726 Nonsense 396 590 10 15
ENSDART00000075730 Nonsense 447 641 11 16
Genomic Location (Zv9):
Chromosome 23 (position 32062113)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 31897003
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTCAGACAGTCAAAATATACCAGTCACGCCATCGCCGGTCTGCTCCCAG[A/T]AAGCACTGCAGCAAGACCTTGCTCTTCGACCTCAGAAGGAAAATGAGCTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link