si:ch211-145n14.1

Ensembl ID:
ENSDARG00000053665
ZFIN ID:
ZDB-GENE-091118-65
Description:
LOC553402 protein [Source:UniProtKB/TrEMBL;Acc:Q561U3]
Human Orthologue:
GABRG2
Human Description:
gamma-aminobutyric acid (GABA) A receptor, gamma 2 [Source:HGNC Symbol;Acc:4087]
Mouse Orthologue:
Gabrg2
Mouse Description:
gamma-aminobutyric acid (GABA) A receptor, subunit gamma 2 Gene [Source:MGI Symbol;Acc:MGI:95623]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17984 Splice Site, Nonsense Available for shipment Available now
sa32358 Nonsense Available for shipment Available now
sa24028 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa17984
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075740 Splice Site, Nonsense 88 370 3 8
ENSDART00000092821 Splice Site, Nonsense 88 469 3 9
Genomic Location (Zv9):
Chromosome 21 (position 40808541)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 41962167
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGAACTAATTTGACATTCTCTTTGTTTCTCTCCACTTCTCTTTATAGTC[A/T]AACCCACTGTGATCCATACGGACATGTTTGTGAACAGTATTGGCCCAGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32358
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075740 Nonsense 126 370 4 8
ENSDART00000092821 Nonsense 126 469 4 9
Genomic Location (Zv9):
Chromosome 21 (position 40815051)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 41955657
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAGTACACAATTGACATCTTCTTCGCCCAGACGTGGTATGACAGACGGT[T/A]GAAGTTTAACAGTACCATGAAGGTTCTACGCCTCAACAGCAACATGGTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24028
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075740 Essential Splice Site 256 370 6 8
ENSDART00000092821 Essential Splice Site 256 469 6 9
Genomic Location (Zv9):
Chromosome 21 (position 40827687)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 41943021
KASP Assay ID:
2261-6065.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCTTTTGTTGGCCTGAGAAATACCTCAGAGGTTGTCAGGACTGTCTCAG[G/A]TACGGCTTCGGTTTTACTCAGCATCTCTATCCTTTTATGTATGTTTGTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link