gb:bc097249

Ensembl ID:
ENSDARG00000053652
ZFIN ID:
ZDB-GENE-100112-1
Description:
LOC569692 protein [Source:UniProtKB/TrEMBL;Acc:Q4V8Q6]
Human Orthologue:
C8orf38
Human Description:
chromosome 8 open reading frame 38 [Source:HGNC Symbol;Acc:28625]
Mouse Orthologue:
2310030N02Rik
Mouse Description:
RIKEN cDNA 2310030N02 gene Gene [Source:MGI Symbol;Acc:MGI:1924197]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa17886 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa17886
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075718 Essential Splice Site 76 343 1 9
Genomic Location:
Chromosome 16 (position 43174911)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAAACTCGACACGACAGCACAATGAACAGTACTGTATTGACAKAGTAAGG[T/A]AAGTTTTGAGTTAAAAGGTTCATTTGCTTKATATAGTTTTACATGGAAGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/b3mkx2dq