or135-1

Ensembl ID:
ENSDARG00000053648
ZFIN ID:
ZDB-GENE-070806-32
Description:
odorant receptor, family H, subfamily 135, member 1 [Source:RefSeq peptide;Acc:NP_001077338]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa21348 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21348
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075715 Nonsense 272 317 2 2
ENSDART00000147239 Nonsense 260 306 1 1
Genomic Location (Zv9):
Chromosome 8 (position 38640702)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 37496117
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGGATGGGGCTTTGACAAGTCGCTTTCCTGACTACAGGCAAATAATCTA[C/A]TACTGCACCTTTATTCTTACCAGCATTTTGCCACGGTTATTAAGTCCACT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link